| Detail of EST/Unigene CN747218 |
| Acc. | CN747218 |
| Internal Acc. | SAL_US025xh12f1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 657 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US; |
| Sequence | CTTTTTTCTTGATAAACCATGGCAGCTGCTACAATGGCTCTTTCTTCCCCTTCTTTTGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |