Detail of EST/Unigene CN747465 |
Acc. | CN747465 |
Internal Acc. | SAL_US007xn19f1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=1e-51; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=2e-50; Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=7e-46; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-30; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-30; |
Length | 522 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | AAAACACTTCATCTCCTTATAAACAATGGCTGCTTCTACAAGGCTCTCTCCTCTTCTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |