Detail of EST/Unigene CN747548 |
Acc. | CN747548 |
Internal Acc. | SAL_US007xn20r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=4e-40; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=8e-31; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=3e-27; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-26; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-26; |
Length | 524 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | AAAATCTTTCTATTGTCGGTAACTCATCACAACATCTTTACAAGAACCATCAAACAATTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822391 |
Trichome-related Gene from Literature | N/A |