| Detail of EST/Unigene CN747548 |
| Acc. | CN747548 |
| Internal Acc. | SAL_US007xn20r1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB10, chloroplastic OS=Malus domestica E-value=4e-40; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=8e-31; Chlorophyll a-b binding protein 1D (Fragment) OS=Solanum lycopersicum E-value=3e-27; Chlorophyll a-b binding protein 1C, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-26; Chlorophyll a-b binding protein 1A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=2e-26; |
| Length | 524 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US; |
| Sequence | AAAATCTTTCTATTGTCGGTAACTCATCACAACATCTTTACAAGAACCATCAAACAATTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |