| Detail of EST/Unigene CN747794 |
| Acc. | CN747794 |
| Internal Acc. | SAL_US008xm06r1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-37; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-37; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=4e-37; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=5e-37; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=6e-37; |
| Length | 399 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US; |
| Sequence | TGGCACATAAAGATTCTTCTGTTGTCAATAACTCACAACAACTTTACAGGACCATCAAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |