Detail of EST/Unigene CN748010 |
Acc. | CN748010 |
Internal Acc. | SAL_US003xc19r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=2e-58; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=8e-58; Chlorophyll a-b binding protein type 2 member 2 (Fragment) OS=Pinus sylvestris E-value=2e-56; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=4e-55; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-55; |
Length | 457 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | TTTTNTAGAAACTTCACTTTCCGGGAAACAAGTTTGTGGCATAGGCCCAGGCGTTGTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |