Detail of EST/Unigene CN748094 |
Acc. | CN748094 |
Internal Acc. | SAL_US004xm16r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=1e-41; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=6e-40; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=8e-40; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-39; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=1e-39; |
Length | 331 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | CATCAACATTAATTTTAAGATGTTTCACAATATTTATTTTCCGGGGACAAAGTTTGTGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |