| Detail of EST/Unigene CN748094 |
| Acc. | CN748094 |
| Internal Acc. | SAL_US004xm16r1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=1e-41; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=6e-40; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=8e-40; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=1e-39; Chlorophyll a-b binding protein of LHCII type 1 (Fragment) OS=Cucumis sativus E-value=1e-39; |
| Length | 331 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US; |
| Sequence | CATCAACATTAATTTTAAGATGTTTCACAATATTTATTTTCCGGGGACAAAGTTTGTGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |