Detail of EST/Unigene CN748358 |
Acc. | CN748358 |
Internal Acc. | SAL_US028xa12r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=3e-93; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=9e-93; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-92; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=2e-92; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=2e-92; |
Length | 587 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | AAATAAAAATCATTCTATTGTCGAGTAACACAAAACAACTTTACAAGGCCATCAACAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |