| Detail of EST/Unigene CN748526 |
| Acc. | CN748526 |
| Internal Acc. | SAL_US028xj11r1.ab1 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=1e-62; Chlorophyll a-b binding protein 151, chloroplastic OS=Gossypium hirsutum E-value=3e-62; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=1e-61; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=4e-61; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=7e-61; |
| Length | 542 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US; |
| Sequence | TCAAGTAGCTCACAACAACTTTACAAGATATTAAACAATTAAATTTTAAGATTTTTTTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |