Detail of EST/Unigene CN748845 |
Acc. | CN748845 |
Internal Acc. | SAL_US029xm08r1.ab1 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=2e-77; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-77; Chlorophyll a-b binding protein, chloroplastic OS=Oryza sativa subsp. indica E-value=2e-77; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=3e-77; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=4e-75; |
Length | 561 nt |
Species | Nicotiana benthamiana |
Belonged EST Libraries | NB_SAL_US; |
Sequence | GGCTAGAACCATTTGCATTAGTATTAGCAAGCTCATTTACATCAAGAATATGAAACAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |