| Detail of EST/Unigene CO511776 |
| Acc. | CO511776 |
| Internal Acc. | s13dSG01H1000092_103452 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase L3 OS=Arabidopsis thaliana E-value=3e-66; Glutathione S-transferase L1 OS=Arabidopsis thaliana E-value=5e-65; Protein IN2-1 homolog B OS=Oryza sativa subsp. japonica E-value=5e-58; Protein IN2-1 homolog B OS=Oryza sativa subsp. indica E-value=5e-58; Glutathione S-transferase L2, chloroplastic OS=Arabidopsis thaliana E-value=8e-58; |
| Length | 550 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GTGAAACAAGTTCTTCCTCCTCCGTTAACATCAACTTCTGAACCACCACCTCTTTTTGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831798 |
| Trichome-related Gene from Literature | N/A |