Detail of EST/Unigene CO511791 |
Acc. | CO511791 |
Internal Acc. | s13dSG02B0100013_103482 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II 10 kDa polypeptide, chloroplastic OS=Nicotiana tabacum E-value=7e-43; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum tuberosum E-value=5e-42; Photosystem II 10 kDa polypeptide, chloroplastic OS=Solanum lycopersicum E-value=1e-41; Photosystem II 10 kDa polypeptide, chloroplastic OS=Brassica campestris E-value=5e-39; Photosystem II 10 kDa polypeptide, chloroplastic OS=Arabidopsis thaliana E-value=5e-39; |
Length | 549 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TTCTGTGAGTTTGAAACCAACTCCTTTCAGAGTTGAGAAATCTTCAGTTAGAGGACTACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844245 |
Trichome-related Gene from Literature | N/A |