| Detail of EST/Unigene CO512107 |
| Acc. | CO512107 |
| Internal Acc. | s13dSG18H1200096_108534 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 84A1 OS=Arabidopsis thaliana E-value=5e-67; Cytochrome P450 71D95 OS=Mentha spicata E-value=2e-35; Cytochrome P450 71D95 OS=Mentha gracilis E-value=2e-35; Cytochrome P450 71D8 OS=Glycine max E-value=5e-35; Cytochrome P450 71D13 OS=Mentha piperita E-value=1e-34; |
| Length | 490 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | TTGAAGAACCCGATTTCGAGAAACTAACCTATCTAAAATGCGCTCTTAAGGAAACCCTAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K01832 cytochrome P450, family 5, subfamily A (thromboxane-A synthase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochro |
| EC | 1.14.14.1 5.3.99.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829779 |
| Trichome-related Gene from Literature | N/A |