Detail of EST/Unigene CO512188 |
Acc. | CO512188 |
Internal Acc. | s13dSG03A1000069_113890 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S15, chloroplastic OS=Cicer arietinum E-value=6e-25; 30S ribosomal protein S15, chloroplastic OS=Lotus japonicus E-value=2e-24; 30S ribosomal protein S15, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=2e-23; 30S ribosomal protein S15, chloroplastic OS=Buxus microphylla E-value=2e-22; 30S ribosomal protein S15, chloroplastic OS=Glycine max E-value=3e-22; |
Length | 298 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | GGGATATACAAAATTAAAAATTAGTGTCATTACTATTACTGATCAATAAAAATATCTACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |