Detail of EST/Unigene CO512266 |
Acc. | CO512266 |
Internal Acc. | s13dSG03H1100092_114046 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-64; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=2e-63; Glutathione S-transferase U22 OS=Arabidopsis thaliana E-value=2e-63; Glutathione S-transferase U19 OS=Arabidopsis thaliana E-value=2e-62; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=5e-61; |
Length | 561 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | ACATTTCTTTTCTTCTTCTTCCATAACAATTCTTCATTCTTTTCTTTCTGTGTTAATCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 844169 |
Trichome-related Gene from Literature | N/A |