Detail of EST/Unigene CO512339 |
Acc. | CO512339 |
Internal Acc. | s13dSG68G0900068_114192 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=2e-60; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=1e-43; Glutathione S-transferase U1 OS=Arabidopsis thaliana E-value=7e-42; Glutathione S-transferase U5 OS=Arabidopsis thaliana E-value=2e-38; Glutathione S-transferase U6 OS=Arabidopsis thaliana E-value=2e-38; |
Length | 437 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TACAAATCAGGAAGATGTGAAACTTTTGGGAATTGTGGGAAGCCCATTTTTTTGCAGGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817491 |
Trichome-related Gene from Literature | N/A |