| Detail of EST/Unigene CO512469 |
| Acc. | CO512469 |
| Internal Acc. | s13dSG100D050004_114452 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=4e-85; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-78; Chlorophyll a-b binding protein 1B-20, chloroplastic (Fragment) OS=Hordeum vulgare Ib-20 E-value=3e-47; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=3e-40; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=2e-39; |
| Length | 485 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GTGGTTTGAAATCAAGGTTCCTTACTGGTTCTTCTGGTAAGTTGAACAGAGAAGTGTCTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823901 |
| Trichome-related Gene from Literature | N/A |