| Detail of EST/Unigene CO512741 |
| Acc. | CO512741 |
| Internal Acc. | s13dSG88B0100009_121408 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=3e-79; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=2e-73; Oxygen-evolving enhancer protein 1, chloroplastic OS=Spinacia oleracea E-value=4e-73; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=4e-73; Oxygen-evolving enhancer protein 1, chloroplastic OS=Fritillaria agrestis E-value=1e-71; |
| Length | 580 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | ATCTGTCAAATTTGAGGAGAAAGACGGCATTGACTACGCCGCAGTCACAGTTCAGCTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824246 |
| Trichome-related Gene from Literature | N/A |