Detail of EST/Unigene CO512741 |
Acc. | CO512741 |
Internal Acc. | s13dSG88B0100009_121408 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=3e-79; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=2e-73; Oxygen-evolving enhancer protein 1, chloroplastic OS=Spinacia oleracea E-value=4e-73; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=4e-73; Oxygen-evolving enhancer protein 1, chloroplastic OS=Fritillaria agrestis E-value=1e-71; |
Length | 580 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | ATCTGTCAAATTTGAGGAGAAAGACGGCATTGACTACGCCGCAGTCACAGTTCAGCTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824246 |
Trichome-related Gene from Literature | N/A |