Detail of EST/Unigene CO512867 |
Acc. | CO512867 |
Internal Acc. | s13dSG20F0800063_121660 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=2e-68; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=3e-53; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=1e-52; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=9e-52; Oxygen-evolving enhancer protein 2-1, chloroplastic OS=Nicotiana tabacum E-value=1e-49; |
Length | 500 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TCTACACAATGCTTCTTGCACCCCCAATATGCTCTTACAACTCCATCTAGAAGTTTGTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837178 |
Trichome-related Gene from Literature | N/A |