Detail of EST/Unigene CO512952 |
Acc. | CO512952 |
Internal Acc. | s13dSG86G0700052_121830 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=2e-77; Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=2e-77; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=5e-17; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=1e-16; Reticulon-4-interacting protein 1, mitochondrial OS=Mus musculus E-value=5e-16; |
Length | 593 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | GGGTGGAGGTGGACTAGCTGAGTTTGCCGTGGCTAGCGAGAGCTTAACAGCTGCCAGACC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826914 |
Trichome-related Gene from Literature | N/A |