| Detail of EST/Unigene CO512952 |
| Acc. | CO512952 |
| Internal Acc. | s13dSG86G0700052_121830 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=2e-77; Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=2e-77; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=5e-17; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=1e-16; Reticulon-4-interacting protein 1, mitochondrial OS=Mus musculus E-value=5e-16; |
| Length | 593 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GGGTGGAGGTGGACTAGCTGAGTTTGCCGTGGCTAGCGAGAGCTTAACAGCTGCCAGACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826914 |
| Trichome-related Gene from Literature | N/A |