Detail of EST/Unigene CO512968 |
Acc. | CO512968 |
Internal Acc. | s13dSG09A0300017_121862 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=8e-85; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=1e-70; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=2e-70; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=4e-69; Oxygen-evolving enhancer protein 1-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-64; |
Length | 507 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | AGCCTCACTACAAGCAGCTGCTACTCTCATGCAACCAACCAAGTTACGTAGCAACAGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |