| Detail of EST/Unigene CO513040 |
| Acc. | CO513040 |
| Internal Acc. | s13dSG09H1200096_122006 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L36, chloroplastic OS=Lotus japonicus E-value=1e-06; 50S ribosomal protein L36, chloroplastic OS=Pisum sativum E-value=2e-06; 50S ribosomal protein L36, chloroplastic OS=Nymphaea alba E-value=4e-06; 50S ribosomal protein L36, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-06; |
| Length | 182 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GGGAAGGAGTTAAATTCAAAATATGAAAGTAGGAGCCTCTGTTCGTAAAATTTGTGAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |