Detail of EST/Unigene CO513040 |
Acc. | CO513040 |
Internal Acc. | s13dSG09H1200096_122006 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L36, chloroplastic OS=Lotus japonicus E-value=1e-06; 50S ribosomal protein L36, chloroplastic OS=Pisum sativum E-value=2e-06; 50S ribosomal protein L36, chloroplastic OS=Nymphaea alba E-value=4e-06; 50S ribosomal protein L36, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-06; |
Length | 182 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | GGGAAGGAGTTAAATTCAAAATATGAAAGTAGGAGCCTCTGTTCGTAAAATTTGTGAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |