Detail of EST/Unigene CO513675 |
Acc. | CO513675 |
Internal Acc. | s13dSG17F0700059_140132 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 80 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TTGCAATCAGTTCTTCAAGAGGATTTTAAGGCCATTGATATTGAGGTTGGAGTGGTGCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833524 |
Trichome-related Gene from Literature | N/A |