Detail of EST/Unigene CO513707 |
Acc. | CO513707 |
Internal Acc. | s13dSG15B0900073_140196 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S14, chloroplastic OS=Cicer arietinum E-value=2e-31; 30S ribosomal protein S14, chloroplastic OS=Lotus japonicus E-value=1e-29; 30S ribosomal protein S14, chloroplastic OS=Lobularia maritima E-value=6e-29; 30S ribosomal protein S14, chloroplastic OS=Lactuca sativa E-value=1e-28; 30S ribosomal protein S14, chloroplastic OS=Helianthus annuus E-value=1e-28; |
Length | 212 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | AATAAGAAAAGCTCAGTCCTTAAGTGAGAAATGGGAAATTCAGGGAAAGTTAGAAGCACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |