Detail of EST/Unigene CO513710 |
Acc. | CO513710 |
Internal Acc. | s13dSG15C0100002_140202 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=2e-19; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=3e-11; Carboxymethylenebutenolidase homolog OS=Pongo abelii E-value=4e-10; Carboxymethylenebutenolidase homolog OS=Homo sapiens E-value=4e-10; Carboxymethylenebutenolidase homolog OS=Rattus norvegicus E-value=1e-09; |
Length | 405 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | CCTCCCTGGAACAATAGAAACAAGTGTCTGAAAGAAAGAAAGAAAGAATGTCGGGAGCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.-.- 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821939 |
Trichome-related Gene from Literature | N/A |