Detail of EST/Unigene CO514060 |
Acc. | CO514060 |
Internal Acc. | s13dSG72H0300028_156782 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Spinacia oleracea E-value=7e-26; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=6e-25; Transketolase, chloroplastic OS=Zea mays E-value=9e-25; Transketolase, chloroplastic OS=Solanum tuberosum E-value=1e-23; Transketolase 10 OS=Craterostigma plantagineum E-value=5e-21; |
Length | 216 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | GGGATTGGAACTGGTTCTGAGTTGGAAATTGCCGCTGCCGCCGCTGATGATCTAAGGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825246 |
Trichome-related Gene from Literature | N/A |