| Detail of EST/Unigene CO514060 |
| Acc. | CO514060 |
| Internal Acc. | s13dSG72H0300028_156782 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Spinacia oleracea E-value=7e-26; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=6e-25; Transketolase, chloroplastic OS=Zea mays E-value=9e-25; Transketolase, chloroplastic OS=Solanum tuberosum E-value=1e-23; Transketolase 10 OS=Craterostigma plantagineum E-value=5e-21; |
| Length | 216 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GGGATTGGAACTGGTTCTGAGTTGGAAATTGCCGCTGCCGCCGCTGATGATCTAAGGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825246 |
| Trichome-related Gene from Literature | N/A |