Detail of EST/Unigene CO514077 |
Acc. | CO514077 |
Internal Acc. | s13dSG75A0800053_156816 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit III, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; Photosystem I reaction center subunit III, chloroplastic OS=Flaveria trinervia E-value=9e-12; Photosystem I reaction center subunit III, chloroplastic OS=Spinacia oleracea E-value=8e-11; Photosystem I reaction center subunit III, chloroplastic OS=Hordeum vulgare E-value=6e-08; |
Length | 360 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TAACAACACACAAATCAAATCCAACACCCTTCACTCCCTCTTCTCTTCTTCCACACAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840021 |
Trichome-related Gene from Literature | N/A |