| Detail of EST/Unigene CO514077 |
| Acc. | CO514077 |
| Internal Acc. | s13dSG75A0800053_156816 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit III, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; Photosystem I reaction center subunit III, chloroplastic OS=Flaveria trinervia E-value=9e-12; Photosystem I reaction center subunit III, chloroplastic OS=Spinacia oleracea E-value=8e-11; Photosystem I reaction center subunit III, chloroplastic OS=Hordeum vulgare E-value=6e-08; |
| Length | 360 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | TAACAACACACAAATCAAATCCAACACCCTTCACTCCCTCTTCTCTTCTTCCACACAAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840021 |
| Trichome-related Gene from Literature | N/A |