| Detail of EST/Unigene CO514524 |
| Acc. | CO514524 |
| Internal Acc. | s13dSG43G0400034_327708 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S14, chloroplastic OS=Cicer arietinum E-value=1e-37; 30S ribosomal protein S14, chloroplastic OS=Lotus japonicus E-value=5e-36; 30S ribosomal protein S14, chloroplastic OS=Lobularia maritima E-value=2e-35; 30S ribosomal protein S14, chloroplastic OS=Arabidopsis thaliana E-value=2e-35; 30S ribosomal protein S14, chloroplastic OS=Lactuca sativa E-value=3e-35; |
| Length | 460 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | TTTCTTGATTGCCTCTACATCAGGTAAATTTGGTTAATTTGATTCTTTATTGTATCTGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |