Detail of EST/Unigene CO514534 |
Acc. | CO514534 |
Internal Acc. | s13dSG43H0300030_327728 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=1e-72; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=1e-68; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=7e-68; Protochlorophyllide reductase, chloroplastic OS=Cucumis sativus E-value=1e-67; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=2e-67; |
Length | 521 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | GGTTCGTCGATAACTTCAGGCGATCTGAAATGCCGTTGGATGTGCTTGTTAACAGTGCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828853 |
Trichome-related Gene from Literature | N/A |