| Detail of EST/Unigene CO514534 |
| Acc. | CO514534 |
| Internal Acc. | s13dSG43H0300030_327728 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protochlorophyllide reductase, chloroplastic OS=Pisum sativum E-value=1e-72; Protochlorophyllide reductase, chloroplastic OS=Daucus carota E-value=1e-68; Protochlorophyllide reductase B, chloroplastic OS=Arabidopsis thaliana E-value=7e-68; Protochlorophyllide reductase, chloroplastic OS=Cucumis sativus E-value=1e-67; Protochlorophyllide reductase A, chloroplastic OS=Arabidopsis thaliana E-value=2e-67; |
| Length | 521 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GGTTCGTCGATAACTTCAGGCGATCTGAAATGCCGTTGGATGTGCTTGTTAACAGTGCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828853 |
| Trichome-related Gene from Literature | N/A |