| Detail of EST/Unigene CO514601 |
| Acc. | CO514601 |
| Internal Acc. | s13dSG42G0300024_327862 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S12-B, chloroplastic OS=Populus trichocarpa E-value=6e-48; 30S ribosomal protein S12-B, chloroplastic OS=Olimarabidopsis pumila E-value=7e-43; 30S ribosomal protein S12, chloroplastic OS=Glycine max E-value=2e-42; 30S ribosomal protein S12, chloroplastic OS=Phaseolus vulgaris E-value=2e-42; 30S ribosomal protein S12, chloroplastic OS=Lotus japonicus E-value=2e-42; |
| Length | 623 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | AACATGAAAACGTGACTGACTGAATTAGTTCTCGTTATTTTTAGGGAAGGAGTGGAGATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |