Detail of EST/Unigene CO514601 |
Acc. | CO514601 |
Internal Acc. | s13dSG42G0300024_327862 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S12-B, chloroplastic OS=Populus trichocarpa E-value=6e-48; 30S ribosomal protein S12-B, chloroplastic OS=Olimarabidopsis pumila E-value=7e-43; 30S ribosomal protein S12, chloroplastic OS=Glycine max E-value=2e-42; 30S ribosomal protein S12, chloroplastic OS=Phaseolus vulgaris E-value=2e-42; 30S ribosomal protein S12, chloroplastic OS=Lotus japonicus E-value=2e-42; |
Length | 623 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | AACATGAAAACGTGACTGACTGAATTAGTTCTCGTTATTTTTAGGGAAGGAGTGGAGATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |