Detail of EST/Unigene CO514660 |
Acc. | CO514660 |
Internal Acc. | s13dSG46E0500039_327980 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-80; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=3e-80; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-80; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=1e-79; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-79; |
Length | 492 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TGCTTCAACAATGTCCCTCTCTTCATCATCATTTGTAGGGAAGGCAATCAACCTTTCCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839870 |
Trichome-related Gene from Literature | 839870 |