Detail of EST/Unigene CO514715 |
Acc. | CO514715 |
Internal Acc. | s13dSG55C0500038_328090 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit VI, chloroplastic OS=Brassica rapa E-value=7e-44; Photosystem I reaction center subunit VI-2, chloroplastic OS=Arabidopsis thaliana E-value=2e-43; Photosystem I reaction center subunit VI, chloroplastic OS=Spinacia oleracea E-value=1e-42; Photosystem I reaction center subunit VI-1, chloroplastic OS=Arabidopsis thaliana E-value=2e-42; Photosystem I reaction center subunit VI, chloroplastic OS=Zea mays E-value=2e-35; |
Length | 579 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | CACAAGAGGAAGAGAATTAAGTGGAAAATAATAAACCATATGGCTTCCCTTGCTACCTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841653 |
Trichome-related Gene from Literature | N/A |