| Detail of EST/Unigene CO514850 |
| Acc. | CO514850 |
| Internal Acc. | s13dSG56A1000081_328360 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-81; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=8e-80; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=5e-73; Chlorophyll a-b binding protein 3, chloroplastic OS=Glycine max E-value=5e-73; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-73; |
| Length | 470 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GCATCATCCATGGCTCTCTCTTCACCAACCTTGGCTGGCAAGCCAGTCAAGCTAACCCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |