Detail of EST/Unigene CO514902 |
Acc. | CO514902 |
Internal Acc. | s13dSG56G0500040_328464 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=5e-35; Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum E-value=3e-34; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=3e-28; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=4e-28; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=3e-27; |
Length | 291 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | CCATTCATACGAGTACATTTATCAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |