Detail of EST/Unigene CO514936 |
Acc. | CO514936 |
Internal Acc. | s13dSG63C0300022_397377 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Spermine synthase OS=Arabidopsis thaliana E-value=3e-45; Spermidine synthase 1 OS=Arabidopsis thaliana E-value=7e-20; Spermidine synthase 2 OS=Arabidopsis thaliana E-value=2e-19; Spermidine synthase OS=Solanum lycopersicum E-value=9e-19; Spermidine synthase 2 OS=Datura stramonium E-value=1e-18; |
Length | 494 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | GGGGCCAGAAGAAGCAATCAAAGAACTGTGAGAGAGAGAAAGAGCCGCGTTTCTATCAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
EC | 2.5.1.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835392 |
Trichome-related Gene from Literature | N/A |