Detail of EST/Unigene CO515167 |
Acc. | CO515167 |
Internal Acc. | s13dSG62B1000089_399199 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 13, chloroplastic OS=Solanum lycopersicum E-value=3e-62; Chlorophyll a-b binding protein of LHCII type III, chloroplastic OS=Hordeum vulgare E-value=7e-56; Chlorophyll a-b binding protein 4, chloroplastic OS=Solanum lycopersicum E-value=3e-39; Chlorophyll a-b binding protein 37, chloroplastic OS=Petunia sp. E-value=2e-38; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=2e-38; |
Length | 483 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | CACATTTCTAGTATCAGTTATTTGAGTGAACTAAGGTTTCAACAAGAAGCACTTGAAAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835515 |
Trichome-related Gene from Literature | N/A |