Detail of EST/Unigene CO515179 |
Acc. | CO515179 |
Internal Acc. | s13dSG62C1100086_399223 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 1A OS=Arabidopsis thaliana E-value=4e-50; SKP1-like protein 4 OS=Arabidopsis thaliana E-value=5e-50; SKP1-like protein 1B OS=Arabidopsis thaliana E-value=3e-48; SKP1-like protein 3 OS=Arabidopsis thaliana E-value=5e-47; SKP1-like protein 11 OS=Arabidopsis thaliana E-value=3e-42; |
Length | 498 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GTCTCACAAATTTCCAATAAGAAAAAAAAGTTAGGGTTAGCAATTTCACATCTTTCACAA |
EST members of Unigene | CO515179 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1361.1.S1_at
|
Corresponding NCBI Gene | 843928 |
Trichome-related Gene from Literature | N/A |