Detail of EST/Unigene CO515395 |
Acc. | CO515395 |
Internal Acc. | s13dSG49G0700056_417849 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Mn], mitochondrial OS=Pisum sativum E-value=8e-73; Superoxide dismutase [Mn], mitochondrial OS=Prunus persica E-value=5e-66; Superoxide dismutase [Mn], mitochondrial OS=Nicotiana plumbaginifolia E-value=9e-66; Superoxide dismutase [Mn], mitochondrial OS=Hevea brasiliensis E-value=9e-64; Superoxide dismutase [Mn], mitochondrial OS=Capsicum annuum E-value=2e-63; |
Length | 527 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | GGGGTTCTCAATCATCATCATCTTCCACCATGGCCGTTCGAACCCTACTGAGCAAAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.15.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820263 |
Trichome-related Gene from Literature | N/A |