Detail of EST/Unigene CO516121 |
Acc. | CO516121 |
Internal Acc. | s13dSG65F0200015_445570 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Calcium-binding allergen Ole e 8 OS=Olea europaea E-value=3e-16; Probable calcium-binding protein CML27 OS=Arabidopsis thaliana E-value=5e-14; Probable calcium-binding protein CML26 OS=Arabidopsis thaliana E-value=1e-13; Polcalcin Phl p 7 OS=Phleum pratense E-value=3e-13; Polcalcin Cyn d 7 OS=Cynodon dactylon E-value=5e-13; |
Length | 326 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TTCACCACCATACAAACAAATATACGCTTTTCGTTTTCTGTTATTCATTCAATTCCTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K02183 calmodulin; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K02183 calmodulin; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K05865 troponin C |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 9.A.1 Polysaccharide transporter PST; 9.A.14 Nuclear pore complex NPC |
Probeset |
|
Corresponding NCBI Gene | 838401 |
Trichome-related Gene from Literature | N/A |