| Detail of EST/Unigene CO516121 |
| Acc. | CO516121 |
| Internal Acc. | s13dSG65F0200015_445570 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcium-binding allergen Ole e 8 OS=Olea europaea E-value=3e-16; Probable calcium-binding protein CML27 OS=Arabidopsis thaliana E-value=5e-14; Probable calcium-binding protein CML26 OS=Arabidopsis thaliana E-value=1e-13; Polcalcin Phl p 7 OS=Phleum pratense E-value=3e-13; Polcalcin Cyn d 7 OS=Cynodon dactylon E-value=5e-13; |
| Length | 326 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | TTCACCACCATACAAACAAATATACGCTTTTCGTTTTCTGTTATTCATTCAATTCCTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K02183 calmodulin; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K02183 calmodulin; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K05865 troponin C |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.1 Polysaccharide transporter PST; 9.A.14 Nuclear pore complex NPC |
| Probeset |
|
| Corresponding NCBI Gene | 838401 |
| Trichome-related Gene from Literature | N/A |