| Detail of EST/Unigene CO516142 |
| Acc. | CO516142 |
| Internal Acc. | s13dSG65H0600060_445612 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione transferase GST 23 OS=Zea mays E-value=2e-36; Probable glutathione S-transferase OS=Glycine max E-value=2e-35; Glutathione S-transferase U4 OS=Arabidopsis thaliana E-value=2e-35; Glutathione S-transferase U2 OS=Arabidopsis thaliana E-value=4e-35; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-34; |
| Length | 327 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | AGGAGACTCACTCACGTTACTAGGGTTCTGGGGTAGTCCATTTGTCCTGAGGGTCAAGTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00643 Styrene degradation > K01800 maleylacetoacetate isomerase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K01800 maleylacetoacetate isomerase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817495 |
| Trichome-related Gene from Literature | N/A |