Detail of EST/Unigene CO516253 |
Acc. | CO516253 |
Internal Acc. | s13dSG69C0400022_445834 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit VI, chloroplastic OS=Brassica rapa E-value=2e-49; Photosystem I reaction center subunit VI-2, chloroplastic OS=Arabidopsis thaliana E-value=5e-49; Photosystem I reaction center subunit VI-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-48; Photosystem I reaction center subunit VI, chloroplastic OS=Spinacia oleracea E-value=1e-47; Photosystem I reaction center subunit VI, chloroplastic OS=Zea mays E-value=2e-41; |
Length | 452 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | ATCACACAAGAGGAAGAGAATTAAGTGGAAAATAAAAAACCATATGGCTTCCCTTGCTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841653 |
Trichome-related Gene from Literature | N/A |