| Detail of EST/Unigene CO516367 |
| Acc. | CO516367 |
| Internal Acc. | s13dSG99G0600050_446062 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=4e-44; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tabacum E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Nicotiana tomentosiformis E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Nicotiana sylvestris E-value=2e-42; 30S ribosomal protein S3, chloroplastic OS=Solanum tuberosum E-value=3e-42; |
| Length | 542 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GGGTTCTTGCAGAATTTATAGCTGGACAATTAAAGAATAGAATTTCGTTTAGGAAAGCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |