Detail of EST/Unigene CO516373 |
Acc. | CO516373 |
Internal Acc. | s13dSG99H0900078_446074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog MMK2 OS=Medicago sativa E-value=1e-39; Mitogen-activated protein kinase 5 OS=Arabidopsis thaliana E-value=4e-30; Mitogen-activated protein kinase 4 OS=Arabidopsis thaliana E-value=4e-30; Mitogen-activated protein kinase 2 OS=Oryza sativa subsp. japonica E-value=4e-30; Mitogen-activated protein kinase 12 OS=Arabidopsis thaliana E-value=2e-29; |
Length | 332 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TCCTTTCTATATTGGGTCACTTCCTTTTCTTTCTTTCTTTCTTTTATAAATTGAAATAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase |
EC | 2.7.11.24 2.7.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826735 |
Trichome-related Gene from Literature | N/A |