| Detail of EST/Unigene CO516373 |
| Acc. | CO516373 |
| Internal Acc. | s13dSG99H0900078_446074 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog MMK2 OS=Medicago sativa E-value=1e-39; Mitogen-activated protein kinase 5 OS=Arabidopsis thaliana E-value=4e-30; Mitogen-activated protein kinase 4 OS=Arabidopsis thaliana E-value=4e-30; Mitogen-activated protein kinase 2 OS=Oryza sativa subsp. japonica E-value=4e-30; Mitogen-activated protein kinase 12 OS=Arabidopsis thaliana E-value=2e-29; |
| Length | 332 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | TCCTTTCTATATTGGGTCACTTCCTTTTCTTTCTTTCTTTCTTTTATAAATTGAAATAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase |
| EC | 2.7.11.24 2.7.1.37 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826735 |
| Trichome-related Gene from Literature | N/A |