Detail of EST/Unigene CO516388 |
Acc. | CO516388 |
Internal Acc. | s13dSG27B0100009_446104 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Pisum sativum E-value=9e-33; Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=2e-12; Carbonic anhydrase, chloroplastic OS=Nicotiana tabacum E-value=2e-10; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=1e-09; Carbonic anhydrase OS=Flaveria pringlei E-value=3e-08; |
Length | 404 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | CATCATCATAGCTATATAGCATTGTGATTTGAGTCTTCATTGTCACAATGTCTACCTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821134 |
Trichome-related Gene from Literature | N/A |