| Detail of EST/Unigene CO516448 |
| Acc. | CO516448 |
| Internal Acc. | s13dSG28A0500034_446224 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=4e-61; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=3e-44; Glutathione S-transferase U1 OS=Arabidopsis thaliana E-value=4e-42; Glutathione S-transferase U5 OS=Arabidopsis thaliana E-value=1e-38; Glutathione S-transferase U6 OS=Arabidopsis thaliana E-value=1e-38; |
| Length | 436 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | TACAAATCAGGAAGATGTGAAACTTTTGGGAATTGTGGGAAGCCCATTTTTTTGCAGGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817491 |
| Trichome-related Gene from Literature | N/A |