Detail of EST/Unigene CO516526 |
Acc. | CO516526 |
Internal Acc. | s13dSG57B0400029_446380 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase cytosolic isozyme OS=Medicago sativa E-value=1e-44; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=3e-43; Glutamine synthetase root isozyme 4 OS=Zea mays E-value=8e-43; Glutamine synthetase cytosolic isozyme 1-1 OS=Arabidopsis thaliana E-value=1e-42; Glutamine synthetase cytosolic isozyme OS=Lotus japonicus E-value=2e-42; |
Length | 425 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | TTCACAACAATATTTCCGTTTTCGTTTTCATTTGATTCATTGAATCGAATCGAATCGAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
EC | 6.3.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833738 |
Trichome-related Gene from Literature | N/A |