Detail of EST/Unigene CO516597 |
Acc. | CO516597 |
Internal Acc. | s13dSG66A1100083_446522 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=1e-24; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=1e-24; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Chlamydomonas moewusii E-value=3e-09; Chlorophyll a-b binding protein 6A, chloroplastic OS=Solanum lycopersicum E-value=7e-09; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Dunaliella salina E-value=1e-08; |
Length | 386 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | AGTTGAGAACAAAGGAAATTAAGAATGGGAGATTGGCTATGTTGGCTGTGATGGGAGCTT |
EST members of Unigene | CO516597 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34540.1.S1_s_at
|
Corresponding NCBI Gene | 832932 |
Trichome-related Gene from Literature | N/A |