| Detail of EST/Unigene CO516621 |
| Acc. | CO516621 |
| Internal Acc. | s13dSG66D0200014_446570 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Calvin cycle protein CP12-2, chloroplastic OS=Arabidopsis thaliana E-value=7e-33; Calvin cycle protein CP12-1, chloroplastic OS=Arabidopsis thaliana E-value=7e-31; Calvin cycle protein CP12, chloroplastic OS=Chlamydomonas reinhardtii E-value=5e-15; Calvin cycle protein CP12-3, chloroplastic OS=Arabidopsis thaliana E-value=3e-14; |
| Length | 419 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | AACAATAGGTGGTCTAAGCCTTTCAAACCCGAAGCTTCTCTTCAACTCATCAGGATTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825414 |
| Trichome-related Gene from Literature | N/A |