Detail of EST/Unigene CO516866 |
Acc. | CO516866 |
Internal Acc. | s13dSG98G1100086_447060 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=3e-48; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=9e-46; Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=3e-45; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=2e-32; Ribosomal protein S14, mitochondrial OS=Prototheca wickerhamii E-value=7e-22; |
Length | 488 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | GGGCTGGAAGATCATTTCGAGATCTTCGAACATATTCGAGGGTTCAATGTGACTATCGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818015 |
Trichome-related Gene from Literature | 818015 |