| Detail of EST/Unigene CO516866 |
| Acc. | CO516866 |
| Internal Acc. | s13dSG98G1100086_447060 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S14, mitochondrial OS=Vicia faba E-value=3e-48; Ribosomal protein S14, mitochondrial OS=Brassica napus E-value=9e-46; Ribosomal protein S14, mitochondrial OS=Oenothera berteriana E-value=3e-45; Ribosomal protein S14, mitochondrial OS=Marchantia polymorpha E-value=2e-32; Ribosomal protein S14, mitochondrial OS=Prototheca wickerhamii E-value=7e-22; |
| Length | 488 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GGGCTGGAAGATCATTTCGAGATCTTCGAACATATTCGAGGGTTCAATGTGACTATCGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818015 |
| Trichome-related Gene from Literature | 818015 |