| Detail of EST/Unigene CO516995 |
| Acc. | CO516995 |
| Internal Acc. | s13dSG81F0700061_468536 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-phosphate 3-epimerase, cytoplasmic isoform OS=Oryza sativa subsp. japonica E-value=2e-86; Ribulose-phosphate 3-epimerase OS=Homo sapiens E-value=4e-50; Ribulose-phosphate 3-epimerase OS=Pongo abelii E-value=1e-49; Ribulose-phosphate 3-epimerase OS=Mus musculus E-value=1e-49; Ribulose-phosphate 3-epimerase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=9e-47; |
| Length | 516 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1; |
| Sequence | GGGATTCCGGAGCTGATTGGCTTCACATGGATATCATGGATGGGCATTTTGTCCCTAATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K01783 ribulose-phosphate 3-epimerase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K01783 ribulose-phosphate 3-epimerase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01783 ribulose-phosphate 3-epimerase |
| EC | 5.1.3.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821068 |
| Trichome-related Gene from Literature | N/A |