Detail of EST/Unigene CO517007 |
Acc. | CO517007 |
Internal Acc. | s13dSG81H0700062_468560 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 1, chloroplastic OS=Pisum sativum E-value=2e-85; Oxygen-evolving enhancer protein 1, chloroplastic OS=Nicotiana tabacum E-value=3e-69; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum tuberosum E-value=5e-69; Oxygen-evolving enhancer protein 1, chloroplastic OS=Solanum lycopersicum E-value=3e-67; Oxygen-evolving enhancer protein 1, chloroplastic OS=Helianthus annuus E-value=8e-64; |
Length | 509 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1; |
Sequence | AGCCTCACTACAAGCAGCTGCTGCTCTCATGCAACCAACCAAGTTACGTAGCAACAGTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836789 |
Trichome-related Gene from Literature | N/A |